pbr322 origin (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
pbr322 origin
Pbr322 Origin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pbr322+origin/pBR322-TIMER+(Plasmid+%23103056)/pmc12193402-155-8-17
Average 93 stars, based on 14 article reviews
Pbr322 Origin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pbr322+origin/pBR322-TIMER+(Plasmid+%23103056)/pmc12193402-155-8-17
Average 93 stars, based on 14 article reviews
pbr322 origin - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Control:Article Title: A bacterial three-hybrid assay for forward and reverse genetic analysis of RNA-protein interactions Article Snippet: , , pRM17 (addgene #: 174788) , corresponds to p35u4 , . .. pPrey , Cloning:Article Title: A bacterial three-hybrid assay for forward and reverse genetic analysis of RNA-protein interactions Article Snippet: , , pRM17 (addgene #: 174788) , corresponds to p35u4 , . .. pPrey , Article Title: Simplified All-In-One CRISPR-Cas9 Construction for Efficient Genome Editing in Cryptococcus Species Article Snippet: .. In order to obtain a suitable cloning vector, the primer pair pX-F/pX-R was used to amplify the backbone region of pX330 (Addgene plasmid 42230), which contains the Plasmid Preparation:Article Title: Adapting Next-Generation Sequencing to in Process CRISPR-Cas9 Genome Editing of Recombinant Ac MNPV Vectors: From Shotgun to Tiled-Amplicon Sequencing Article Snippet: Briefly, a PCR-amplified SfU6 promoter [ ] gBlock gene fragment and gRNA scaffold along with a transcriptional terminator (Addgene # 49411) [ ] were amplified in a fusion PCR reaction to obtain the SfU6-sgRNA insert with a scrambled spacer sequence (5′-3′ caccttgaagcgcatgaact). .. The backbone containing the ampicillin resistance gene (ampR) and the Article Title: A robust CRISPR interference gene repression system in Vibrio parahaemolyticus Article Snippet: .. The DNA fragment (1798–3107) containing Origin of Replication of pVv3 (NCBI accession # HG326273) was chemically synthesized (Tsingke biology, Nanjing, China) with BbvCI site at 5’-end and NcoI site at 3’-end, and cloned in pBAD18-Kan (ATCC Cat#87,397) between BbvCI and PciI to replace Article Title: Adapting Next-Generation Sequencing to in Process CRISPR-Cas9 Genome Editing of Recombinant Ac MNPV Vectors: From Shotgun to Tiled-Amplicon Sequencing. Article Snippet: Briefly, a PCR-amplified SfU6 promoter [15] gBlock gene fragment and gRNA scaffold along with a transcriptional terminator (Addgene # 49411) [23] were amplified in a fusion PCR reaction to obtain the SfU6-sgRNA insert with a scrambled spacer sequence (5′-3′ caccttgaagcgcatgaact). .. The backbone containing the ampicillin resistance gene (ampR) and the Article Title: A robust CRISPR interference gene repression system in Vibrio parahaemolyticus. Article Snippet: .. The DNA fragment (1798–3107) containing Origin of Replication of pVv3 (NCBI accession # HG326273) was chemically synthesized (Tsingke biology, Nanjing, China) with BbvCI site at 5’-end and NcoI site at 3’-end, and cloned in pBAD18-Kan (ATCC Cat#87,397) between BbvCI and PciI to replace Article Title: Baculovirus Variant Detection from Transient CRISPR-Cas9-Mediated Disruption of gp64 at Different Gene Locations Article Snippet: Briefly, to obtain the SfU6-sgRNA insert, a fusion PCR was performed with a PCR-amplified SfU6 promoter [41] gBlock (synthesized dsDNA) gene fragment (IDT) and a gRNA scaffold with a scrambled spacer sequence (Table 3) at the 5′ end and a transcriptional terminator at the 3′ end (Addgene # 49411) [42] as templates. .. Separately, the ampicillin resistance gene (ampR) and the Article Title: Simplified All-In-One CRISPR-Cas9 Construction for Efficient Genome Editing in Cryptococcus Species Article Snippet: .. In order to obtain a suitable cloning vector, the primer pair pX-F/pX-R was used to amplify the backbone region of pX330 (Addgene plasmid 42230), which contains the Article Title: Baculovirus Variant Detection from Transient CRISPR-Cas9-Mediated Disruption of gp64 at Different Gene Locations Article Snippet: Briefly, to obtain the SfU6-sgRNA insert, a fusion PCR was performed with a PCR-amplified SfU6 promoter [ ] gBlock (synthesized dsDNA) gene fragment (IDT) and a gRNA scaffold with a scrambled spacer sequence ( ) at the 5 ′ end and a transcriptional terminator at the 3 ′ end (Addgene # 49411) [ ] as templates. .. Separately, the ampicillin resistance gene (ampR) and the Polymerase Chain Reaction:Article Title: Adapting Next-Generation Sequencing to in Process CRISPR-Cas9 Genome Editing of Recombinant Ac MNPV Vectors: From Shotgun to Tiled-Amplicon Sequencing Article Snippet: Briefly, a PCR-amplified SfU6 promoter [ ] gBlock gene fragment and gRNA scaffold along with a transcriptional terminator (Addgene # 49411) [ ] were amplified in a fusion PCR reaction to obtain the SfU6-sgRNA insert with a scrambled spacer sequence (5′-3′ caccttgaagcgcatgaact). .. The backbone containing the ampicillin resistance gene (ampR) and the Article Title: A robust CRISPR interference gene repression system in Vibrio parahaemolyticus Article Snippet: .. The DNA fragment (1798–3107) containing Origin of Replication of pVv3 (NCBI accession # HG326273) was chemically synthesized (Tsingke biology, Nanjing, China) with BbvCI site at 5’-end and NcoI site at 3’-end, and cloned in pBAD18-Kan (ATCC Cat#87,397) between BbvCI and PciI to replace Article Title: Adapting Next-Generation Sequencing to in Process CRISPR-Cas9 Genome Editing of Recombinant Ac MNPV Vectors: From Shotgun to Tiled-Amplicon Sequencing. Article Snippet: Briefly, a PCR-amplified SfU6 promoter [15] gBlock gene fragment and gRNA scaffold along with a transcriptional terminator (Addgene # 49411) [23] were amplified in a fusion PCR reaction to obtain the SfU6-sgRNA insert with a scrambled spacer sequence (5′-3′ caccttgaagcgcatgaact). .. The backbone containing the ampicillin resistance gene (ampR) and the Article Title: A robust CRISPR interference gene repression system in Vibrio parahaemolyticus. Article Snippet: .. The DNA fragment (1798–3107) containing Origin of Replication of pVv3 (NCBI accession # HG326273) was chemically synthesized (Tsingke biology, Nanjing, China) with BbvCI site at 5’-end and NcoI site at 3’-end, and cloned in pBAD18-Kan (ATCC Cat#87,397) between BbvCI and PciI to replace Article Title: Baculovirus Variant Detection from Transient CRISPR-Cas9-Mediated Disruption of gp64 at Different Gene Locations Article Snippet: Briefly, to obtain the SfU6-sgRNA insert, a fusion PCR was performed with a PCR-amplified SfU6 promoter [ ] gBlock (synthesized dsDNA) gene fragment (IDT) and a gRNA scaffold with a scrambled spacer sequence ( ) at the 5 ′ end and a transcriptional terminator at the 3 ′ end (Addgene # 49411) [ ] as templates. .. Separately, the ampicillin resistance gene (ampR) and the Synthesized:Article Title: A robust CRISPR interference gene repression system in Vibrio parahaemolyticus Article Snippet: .. The DNA fragment (1798–3107) containing Origin of Replication of pVv3 (NCBI accession # HG326273) was chemically synthesized (Tsingke biology, Nanjing, China) with BbvCI site at 5’-end and NcoI site at 3’-end, and cloned in pBAD18-Kan (ATCC Cat#87,397) between BbvCI and PciI to replace Article Title: A robust CRISPR interference gene repression system in Vibrio parahaemolyticus. Article Snippet: .. The DNA fragment (1798–3107) containing Origin of Replication of pVv3 (NCBI accession # HG326273) was chemically synthesized (Tsingke biology, Nanjing, China) with BbvCI site at 5’-end and NcoI site at 3’-end, and cloned in pBAD18-Kan (ATCC Cat#87,397) between BbvCI and PciI to replace Clone Assay:Article Title: A robust CRISPR interference gene repression system in Vibrio parahaemolyticus Article Snippet: .. The DNA fragment (1798–3107) containing Origin of Replication of pVv3 (NCBI accession # HG326273) was chemically synthesized (Tsingke biology, Nanjing, China) with BbvCI site at 5’-end and NcoI site at 3’-end, and cloned in pBAD18-Kan (ATCC Cat#87,397) between BbvCI and PciI to replace Article Title: A robust CRISPR interference gene repression system in Vibrio parahaemolyticus. Article Snippet: .. The DNA fragment (1798–3107) containing Origin of Replication of pVv3 (NCBI accession # HG326273) was chemically synthesized (Tsingke biology, Nanjing, China) with BbvCI site at 5’-end and NcoI site at 3’-end, and cloned in pBAD18-Kan (ATCC Cat#87,397) between BbvCI and PciI to replace Sequencing:Article Title: A robust CRISPR interference gene repression system in Vibrio parahaemolyticus Article Snippet: .. The DNA fragment (1798–3107) containing Origin of Replication of pVv3 (NCBI accession # HG326273) was chemically synthesized (Tsingke biology, Nanjing, China) with BbvCI site at 5’-end and NcoI site at 3’-end, and cloned in pBAD18-Kan (ATCC Cat#87,397) between BbvCI and PciI to replace Article Title: A robust CRISPR interference gene repression system in Vibrio parahaemolyticus. Article Snippet: .. The DNA fragment (1798–3107) containing Origin of Replication of pVv3 (NCBI accession # HG326273) was chemically synthesized (Tsingke biology, Nanjing, China) with BbvCI site at 5’-end and NcoI site at 3’-end, and cloned in pBAD18-Kan (ATCC Cat#87,397) between BbvCI and PciI to replace |
